In this repository, we present GENERanno, a genomic foundation model featuring a context length of 8k base pairs and 500M parameters, trained on an expansive dataset comprising 386 billion base pairs of eukaryotic DNA. Our evaluations demonstrate that the GENERanno achieves comparable performance with
GENERator
in benchmark evaluations, including
Genomic Benchmarks
,
NT tasks
, and our newly proposed
Gener tasks
, making them the top two genomic foundation models in the field (2025-02).
Beyond benchmark performance, the GENERanno model is meticulously designed with its specialization in gene annotation. The model efficiently and accurately identifies gene locations, predicts gene function, and annotates gene structure, highlighting its potential to revolutionize genomic research by significantly enhancing the precision and efficiency of gene annotation processes.
Please note that the GENERanno is currently in the developmental phase. We are actively refining the model and will release more technical details soon. Stay tuned for updates!
How to use
Simple example: embedding
import torch
from transformers import AutoTokenizer, AutoModel
# Load the tokenizer and model using the pretrained model name
tokenizer = AutoTokenizer.from_pretrained("GenerTeam/GENERanno-eukaryote-0.5b-base")
model = AutoModel.from_pretrained("GenerTeam/GENERanno-eukaryote-0.5b-base", trust_remote_code=True)
# Get model configuration and maximum sequence length
config = model.config
max_length = config.max_position_embeddings
# Define input sequences
sequences = [
"ATGAGGTGGCAAGAAATGGGCTAC",
"GAATTCCATGAGGCTATAGAATAATCTAAGAGAAAT"
]
# Tokenize the sequences# The add_special_tokens=True adds special tokens
tokenizer.padding_side = "right"
inputs = tokenizer(
sequences,
add_special_tokens=True,
return_tensors="pt",
padding=True,
truncation=True,
max_length=max_length
)
# Perform a forward pass through the model to obtain the outputs, including hidden stateswith torch.inference_mode():
outputs = model(**inputs, output_hidden_states=True)
# Retrieve the hidden states from the last layer# hidden_states shape: (batch_size, sequence_length, hidden_size)
hidden_states = outputs.hidden_states[-1]
# Option 1: Use the first token (BOS) as the sentence embedding
cls_embeddings = hidden_states[:, 0, :]
# Option 2: Use mean pooling over the token embeddings# Use the attention mask to take care of the padded tokens
attention_mask = inputs["attention_mask"] # Shape: (batch_size, sequence_length)# Expand the attention mask dimensions so that it matches the hidden_states dimensions
expanded_mask = attention_mask.unsqueeze(-1).expand(hidden_states.size()).to(torch.float32)
# Sum the token embeddings, taking the mask into account
sum_embeddings = torch.sum(hidden_states * expanded_mask, dim=1)
# Compute the average by dividing with the sum of the attention mask
mean_embeddings = sum_embeddings / expanded_mask.sum(dim=1)
print("BOS Embeddings:", cls_embeddings)
print("Mean Embeddings:", mean_embeddings)
Citation
TBD
Runs of GenerTeam GENERanno-eukaryote-0.5b-base on huggingface.co
120
Total runs
0
24-hour runs
10
3-day runs
4
7-day runs
-101
30-day runs
More Information About GENERanno-eukaryote-0.5b-base huggingface.co Model
More GENERanno-eukaryote-0.5b-base license Visit here:
GENERanno-eukaryote-0.5b-base huggingface.co is an AI model on huggingface.co that provides GENERanno-eukaryote-0.5b-base's model effect (), which can be used instantly with this GenerTeam GENERanno-eukaryote-0.5b-base model. huggingface.co supports a free trial of the GENERanno-eukaryote-0.5b-base model, and also provides paid use of the GENERanno-eukaryote-0.5b-base. Support call GENERanno-eukaryote-0.5b-base model through api, including Node.js, Python, http.
GENERanno-eukaryote-0.5b-base huggingface.co is an online trial and call api platform, which integrates GENERanno-eukaryote-0.5b-base's modeling effects, including api services, and provides a free online trial of GENERanno-eukaryote-0.5b-base, you can try GENERanno-eukaryote-0.5b-base online for free by clicking the link below.
GenerTeam GENERanno-eukaryote-0.5b-base online free url in huggingface.co:
GENERanno-eukaryote-0.5b-base is an open source model from GitHub that offers a free installation service, and any user can find GENERanno-eukaryote-0.5b-base on GitHub to install. At the same time, huggingface.co provides the effect of GENERanno-eukaryote-0.5b-base install, users can directly use GENERanno-eukaryote-0.5b-base installed effect in huggingface.co for debugging and trial. It also supports api for free installation.
GENERanno-eukaryote-0.5b-base install url in huggingface.co: