The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.
The team releasing RNA-FM did not write this model card for this model so this model card has been written by the MultiMolecule team.
Model Details
RNA-FM is a
bert
-style model pre-trained on a large corpus of non-coding RNA sequences in a self-supervised fashion. This means that the model was trained on the raw nucleotides of RNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the
Training Details
section for more information on the training process.
Here is how to use this model to get the features of a given sequence in PyTorch:
from multimolecule import RnaTokenizer, RnaFmModel
tokenizer = RnaTokenizer.from_pretrained('multimolecule/mrnafm')
model = RnaFmModel.from_pretrained('multimolecule/mrnafm')
text = "UAGCUUAUCAGACUGAUGUUGA"input = tokenizer(text, return_tensors='pt')
output = model(**input)
Sequence Classification / Regression
Note
: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression.
Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch:
import torch
from multimolecule import RnaTokenizer, RnaFmForSequencePrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/mrnafm')
model = RnaFmForSequencePrediction.from_pretrained('multimolecule/mrnafm')
text = "UAGCUUAUCAGACUGAUGUUGA"input = tokenizer(text, return_tensors='pt')
label = torch.tensor([1])
output = model(**input, labels=label)
Nucleotide Classification / Regression
Note
: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for nucleotide classification or regression.
Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch:
import torch
from multimolecule import RnaTokenizer, RnaFmForNucleotidePrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/mrnafm')
model = RnaFmForNucleotidePrediction.from_pretrained('multimolecule/mrnafm')
text = "UAGCUUAUCAGACUGAUGUUGA"input = tokenizer(text, return_tensors='pt')
label = torch.randint(2, (len(text), ))
output = model(**input, labels=label)
Contact Classification / Regression
Note
: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression.
Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch:
import torch
from multimolecule import RnaTokenizer, RnaFmForContactPrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/mrnafm')
model = RnaFmForContactPrediction.from_pretrained('multimolecule/mrnafm')
text = "UAGCUUAUCAGACUGAUGUUGA"input = tokenizer(text, return_tensors='pt')
label = torch.randint(2, (len(text), len(text)))
output = model(**input, labels=label)
Training Details
RNA-FM used Masked Language Modeling (MLM) as the pre-training objective: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling.
Training Data
The RNA-FM model was pre-trained on
RNAcentral
. RNAcentral is a comprehensive database of non-coding RNA sequences from a wide range of species. It combines 47 different databases, adding up to around 27 million RNA sequences in total.
RNA-FM applied
CD-HIT (CD-HIT-EST)
with a cut-off at 100% sequence identity to remove redundancy from the RNAcentral. The final dataset contains 23.7 million non-redundant RNA sequences.
RNA-FM preprocessed all tokens by replacing "U"s with "T"s.
Note that during model conversions, "T" is replaced with "U". [
RnaTokenizer
][multimolecule.RnaTokenizer] will convert "T"s to "U"s for you, you may disable this behaviour by passing
replace_T_with_U=False
.
Training Procedure
Preprocessing
RNA-FM used masked language modeling (MLM) as the pre-training objective. The masking procedure is similar to the one used in BERT:
15% of the tokens are masked.
In 80% of the cases, the masked tokens are replaced by
<mask>
.
In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace.
In the 10% remaining cases, the masked tokens are left as is.
PreTraining
The model was trained on 8 NVIDIA A100 GPUs with 80GiB memories.
Learning rate: 1e-4
Weight decay: 0.01
Learning rate scheduler: inverse square root
Learning rate warm-up: 10,000 steps
Citation
BibTeX
:
@article{chen2022interpretable,
title={Interpretable rna foundation model from unannotated data for highly accurate rna structure and function predictions},
author={Chen, Jiayang and Hu, Zhihang and Sun, Siqi and Tan, Qingxiong and Wang, Yixuan and Yu, Qinze and Zong, Licheng and Hong, Liang and Xiao, Jin and King, Irwin and others},
journal={arXiv preprint arXiv:2204.00300},
year={2022}
}
Contact
Please use GitHub issues of
MultiMolecule
for any questions or comments on the model card.
Please contact the authors of the
RNA-FM paper
for questions or comments on the paper/model.
mrnafm huggingface.co is an AI model on huggingface.co that provides mrnafm's model effect (), which can be used instantly with this multimolecule mrnafm model. huggingface.co supports a free trial of the mrnafm model, and also provides paid use of the mrnafm. Support call mrnafm model through api, including Node.js, Python, http.
mrnafm huggingface.co is an online trial and call api platform, which integrates mrnafm's modeling effects, including api services, and provides a free online trial of mrnafm, you can try mrnafm online for free by clicking the link below.
multimolecule mrnafm online free url in huggingface.co:
mrnafm is an open source model from GitHub that offers a free installation service, and any user can find mrnafm on GitHub to install. At the same time, huggingface.co provides the effect of mrnafm install, users can directly use mrnafm installed effect in huggingface.co for debugging and trial. It also supports api for free installation.