The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.
The team releasing RiNALMo did not write this model card for this model so this model card has been written by the MultiMolecule team.
Model Details
RiNALMo is a
bert
-style model pre-trained on a large corpus of non-coding RNA sequences in a self-supervised fashion. This means that the model was trained on the raw nucleotides of RNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the
Training Details
section for more information on the training process.
The model file depends on the
multimolecule
library. You can install it using pip:
pip install multimolecule
Direct Use
You can use this model directly with a pipeline for masked language modeling:
>>> import multimolecule # you must import multimolecule to register models>>> from transformers import pipeline
>>> unmasker = pipeline('fill-mask', model='multimolecule/rinalmo')
>>> unmasker("uagc<mask>uaucagacugauguuga")
[{'score': 0.28896641731262207,
'token': 6,
'token_str': 'A',
'sequence': 'U A G C A U A U C A G A C U G A U G U U G A'},
{'score': 0.27602624893188477,
'token': 9,
'token_str': 'U',
'sequence': 'U A G C U U A U C A G A C U G A U G U U G A'},
{'score': 0.18329711258411407,
'token': 12,
'token_str': 'X',
'sequence': 'U A G C X U A U C A G A C U G A U G U U G A'},
{'score': 0.1668907254934311,
'token': 7,
'token_str': 'C',
'sequence': 'U A G C C U A U C A G A C U G A U G U U G A'},
{'score': 0.08479981869459152,
'token': 8,
'token_str': 'G',
'sequence': 'U A G C G U A U C A G A C U G A U G U U G A'}]
Downstream Use
Extract Features
Here is how to use this model to get the features of a given sequence in PyTorch:
from multimolecule import RnaTokenizer, RiNALMoModel
tokenizer = RnaTokenizer.from_pretrained('multimolecule/rinalmo')
model = RiNALMoModel.from_pretrained('multimolecule/rinalmo')
text = "UAGCUUAUCAGACUGAUGUUGA"input = tokenizer(text, return_tensors='pt')
output = model(**input)
Sequence Classification / Regression
Note
: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression.
Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch:
import torch
from multimolecule import RnaTokenizer, RiNALMoForSequencePrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/rinalmo')
model = RiNALMoForSequencePrediction.from_pretrained('multimolecule/rinalmo')
text = "UAGCUUAUCAGACUGAUGUUGA"input = tokenizer(text, return_tensors='pt')
label = torch.tensor([1])
output = model(**input, labels=label)
Nucleotide Classification / Regression
Note
: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for nucleotide classification or regression.
Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch:
import torch
from multimolecule import RnaTokenizer, RiNALMoForNucleotidePrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/rinalmo')
model = RiNALMoForNucleotidePrediction.from_pretrained('multimolecule/rinalmo')
text = "UAGCUUAUCAGACUGAUGUUGA"input = tokenizer(text, return_tensors='pt')
label = torch.randint(2, (len(text), ))
output = model(**input, labels=label)
Contact Classification / Regression
Note
: This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression.
Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch:
import torch
from multimolecule import RnaTokenizer, RiNALMoForContactPrediction
tokenizer = RnaTokenizer.from_pretrained('multimolecule/rinalmo')
model = RiNALMoForContactPrediction.from_pretrained('multimolecule/rinalmo')
text = "UAGCUUAUCAGACUGAUGUUGA"input = tokenizer(text, return_tensors='pt')
label = torch.randint(2, (len(text), len(text)))
output = model(**input, labels=label)
Training Details
RiNALMo used Masked Language Modeling (MLM) as the pre-training objective: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling.
To ensure sequence diversity in each training batch, RiNALMo clustered the sequences with
MMSeqs2
into 17 million clusters and then sampled each sequence in the batch from a different cluster.
RiNALMo preprocessed all tokens by replacing "U"s with "T"s.
Note that during model conversions, "T" is replaced with "U". [
RnaTokenizer
][multimolecule.RnaTokenizer] will convert "T"s to "U"s for you, you may disable this behaviour by passing
replace_T_with_U=False
.
Training Procedure
Preprocessing
RiNALMo used masked language modeling (MLM) as the pre-training objective. The masking procedure is similar to the one used in BERT:
15% of the tokens are masked.
In 80% of the cases, the masked tokens are replaced by
<mask>
.
In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace.
In the 10% remaining cases, the masked tokens are left as is.
PreTraining
The model was trained on 7 NVIDIA A100 GPUs with 80GiB memories.
Learning rate: 5e-5
Learning rate scheduler: cosine
Learning rate warm-up: 2,000 steps
Learning rate minimum: 1e-5
Epochs: 6
Batch Size: 1344
Dropout: 0.1
Citation
BibTeX
:
@article{penic2024rinalmo,
title={RiNALMo: General-Purpose RNA Language Models Can Generalize Well on Structure Prediction Tasks},
author={Penić, Rafael Josip and Vlašić, Tin and Huber, Roland G. and Wan, Yue and Šikić, Mile},
journal={arXiv preprint arXiv:2403.00043},
year={2024}
}
Contact
Please use GitHub issues of
MultiMolecule
for any questions or comments on the model card.
Please contact the authors of the
RiNALMo paper
for questions or comments on the paper/model.
rinalmo huggingface.co is an AI model on huggingface.co that provides rinalmo's model effect (), which can be used instantly with this multimolecule rinalmo model. huggingface.co supports a free trial of the rinalmo model, and also provides paid use of the rinalmo. Support call rinalmo model through api, including Node.js, Python, http.
rinalmo huggingface.co is an online trial and call api platform, which integrates rinalmo's modeling effects, including api services, and provides a free online trial of rinalmo, you can try rinalmo online for free by clicking the link below.
multimolecule rinalmo online free url in huggingface.co:
rinalmo is an open source model from GitHub that offers a free installation service, and any user can find rinalmo on GitHub to install. At the same time, huggingface.co provides the effect of rinalmo install, users can directly use rinalmo installed effect in huggingface.co for debugging and trial. It also supports api for free installation.