multimolecule / rinalmo-mega

huggingface.co
Total runs: 406
24-hour runs: 0
7-day runs: -51
30-day runs: -298
Model's Last Updated: May 11 2026
fill-mask

Introduction of rinalmo-mega

Model Details of rinalmo-mega

RiNALMo

Pre-trained model on non-coding RNA (ncRNA) using a masked language modeling (MLM) objective.

Disclaimer

This is an UNOFFICIAL implementation of the RiNALMo: General-Purpose RNA Language Models Can Generalize Well on Structure Prediction Tasks by Rafael Josip Penić, et al.

The OFFICIAL repository of RiNALMo is at lbcb-sci/RiNALMo .

The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.

The team releasing RiNALMo did not write this model card for this model so this model card has been written by the MultiMolecule team.

Model Details

RiNALMo is a bert -style model pre-trained on a large corpus of non-coding RNA sequences in a self-supervised fashion. This means that the model was trained on the raw nucleotides of RNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the Training Details section for more information on the training process.

Model Specification
Num Layers Hidden Size Num Heads Intermediate Size Num Parameters (M) FLOPs (G) MACs (G) Max Num Tokens
33 1280 20 5120 650.88 168.92 84.43 1022
Links
Usage

The model file depends on the multimolecule library. You can install it using pip:

pip install multimolecule
Direct Use

You can use this model directly with a pipeline for masked language modeling:

>>> import multimolecule  # you must import multimolecule to register models
>>> from transformers import pipeline

>>> unmasker = pipeline("fill-mask", model="multimolecule/rinalmo")
>>> unmasker("gguc<mask>cucugguuagaccagaucugagccu")
[{'score': 0.3932918310165405,
  'token': 6,
  'token_str': 'A',
  'sequence': 'G G U C A C U C U G G U U A G A C C A G A U C U G A G C C U'},
 {'score': 0.2897723913192749,
  'token': 9,
  'token_str': 'U',
  'sequence': 'G G U C U C U C U G G U U A G A C C A G A U C U G A G C C U'},
 {'score': 0.15423105657100677,
  'token': 22,
  'token_str': 'X',
  'sequence': 'G G U C X C U C U G G U U A G A C C A G A U C U G A G C C U'},
 {'score': 0.12160095572471619,
  'token': 7,
  'token_str': 'C',
  'sequence': 'G G U C C C U C U G G U U A G A C C A G A U C U G A G C C U'},
 {'score': 0.0408296100795269,
  'token': 8,
  'token_str': 'G',
  'sequence': 'G G U C G C U C U G G U U A G A C C A G A U C U G A G C C U'}]
Downstream Use
Extract Features

Here is how to use this model to get the features of a given sequence in PyTorch:

from multimolecule import RnaTokenizer, RiNALMoModel


tokenizer = RnaTokenizer.from_pretrained("multimolecule/rinalmo")
model = RiNALMoModel.from_pretrained("multimolecule/rinalmo")

text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")

output = model(**input)
Sequence Classification / Regression

This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression.

Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch:

import torch
from multimolecule import RnaTokenizer, RiNALMoForSequencePrediction


tokenizer = RnaTokenizer.from_pretrained("multimolecule/rinalmo")
model = RiNALMoForSequencePrediction.from_pretrained("multimolecule/rinalmo")

text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
label = torch.tensor([1])

output = model(**input, labels=label)
Token Classification / Regression

This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for token classification or regression.

Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch:

import torch
from multimolecule import RnaTokenizer, RiNALMoForTokenPrediction


tokenizer = RnaTokenizer.from_pretrained("multimolecule/rinalmo")
model = RiNALMoForTokenPrediction.from_pretrained("multimolecule/rinalmo")

text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
label = torch.randint(2, (len(text), ))

output = model(**input, labels=label)
Contact Classification / Regression

This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression.

Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch:

import torch
from multimolecule import RnaTokenizer, RiNALMoForContactPrediction


tokenizer = RnaTokenizer.from_pretrained("multimolecule/rinalmo")
model = RiNALMoForContactPrediction.from_pretrained("multimolecule/rinalmo")

text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
label = torch.randint(2, (len(text), len(text)))

output = model(**input, labels=label)
Training Details

RiNALMo used Masked Language Modeling (MLM) as the pre-training objective: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling.

Training Data

The RiNALMo model was pre-trained on a cocktail of databases including RNAcentral , Rfam , Ensembl Genome Browser , and Nucleotide . The training data contains 36 million unique ncRNA sequences.

To ensure sequence diversity in each training batch, RiNALMo clustered the sequences with MMSeqs2 into 17 million clusters and then sampled each sequence in the batch from a different cluster.

RiNALMo preprocessed all tokens by replacing "U"s with "T"s.

Note that during model conversions, "T" is replaced with "U". [ RnaTokenizer ][multimolecule.RnaTokenizer] will convert "T"s to "U"s for you, you may disable this behaviour by passing replace_T_with_U=False .

Training Procedure
Preprocessing

RiNALMo used masked language modeling (MLM) as the pre-training objective. The masking procedure is similar to the one used in BERT:

  • 15% of the tokens are masked.
  • In 80% of the cases, the masked tokens are replaced by <mask> .
  • In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace.
  • In the 10% remaining cases, the masked tokens are left as is.
Pre-training

The model was trained on 7 NVIDIA A100 GPUs with 80GiB memories.

  • Batch Size: 1344
  • Epochs: 6
  • Learning rate: 5e-5
  • Learning rate scheduler: Cosine
  • Learning rate warm-up: 2,000 steps
  • Learning rate minimum: 1e-5
  • Dropout: 0.1
Citation

BibTeX :

@ARTICLE{Penic2025-qf,
  title     = "{RiNALMo}: general-purpose {RNA} language models can generalize
               well on structure prediction tasks",
  author    = "Peni{\'c}, Rafael Josip and Vla{\v s}i{\'c}, Tin and Huber,
               Roland G and Wan, Yue and {\v S}iki{\'c}, Mile",
  abstract  = "While RNA has recently been recognized as an interesting
               small-molecule drug target, many challenges remain to be
               addressed before we take full advantage of it. This emphasizes
               the necessity to improve our understanding of its structures and
               functions. Over the years, sequencing technologies have produced
               an enormous amount of unlabeled RNA data, which hides a huge
               potential. Motivated by the successes of protein language
               models, we introduce RiboNucleic Acid Language Model (RiNALMo)
               to unveil the hidden code of RNA. RiNALMo is the largest RNA
               language model to date, with 650M parameters pre-trained on 36M
               non-coding RNA sequences from several databases. It can extract
               hidden knowledge and capture the underlying structure
               information implicitly embedded within the RNA sequences.
               RiNALMo achieves state-of-the-art results on several downstream
               tasks. Notably, we show that its generalization capabilities
               overcome the inability of other deep learning methods for
               secondary structure prediction to generalize on unseen RNA
               families.",
  journal   = "Nature Communications",
  publisher = "Springer Science and Business Media LLC",
  volume    =  16,
  number    =  1,
  pages     = "5671",
  month     =  jul,
  year      =  2025,
  copyright = "https://creativecommons.org/licenses/by-nc-nd/4.0",
  language  = "en"
}
Contact

Please use GitHub issues of MultiMolecule for any questions or comments on the model card.

Please contact the authors of the RiNALMo paper for questions or comments on the paper/model.

License

This model is licensed under the AGPL-3.0 License .

SPDX-License-Identifier: AGPL-3.0-or-later

Runs of multimolecule rinalmo-mega on huggingface.co

406
Total runs
0
24-hour runs
0
3-day runs
-51
7-day runs
-298
30-day runs

More Information About rinalmo-mega huggingface.co Model

More rinalmo-mega license Visit here:

https://choosealicense.com/licenses/agpl-3.0

rinalmo-mega huggingface.co

rinalmo-mega huggingface.co is an AI model on huggingface.co that provides rinalmo-mega's model effect (), which can be used instantly with this multimolecule rinalmo-mega model. huggingface.co supports a free trial of the rinalmo-mega model, and also provides paid use of the rinalmo-mega. Support call rinalmo-mega model through api, including Node.js, Python, http.

multimolecule rinalmo-mega online free

rinalmo-mega huggingface.co is an online trial and call api platform, which integrates rinalmo-mega's modeling effects, including api services, and provides a free online trial of rinalmo-mega, you can try rinalmo-mega online for free by clicking the link below.

multimolecule rinalmo-mega online free url in huggingface.co:

https://huggingface.co/multimolecule/rinalmo-mega

rinalmo-mega install

rinalmo-mega is an open source model from GitHub that offers a free installation service, and any user can find rinalmo-mega on GitHub to install. At the same time, huggingface.co provides the effect of rinalmo-mega install, users can directly use rinalmo-mega installed effect in huggingface.co for debugging and trial. It also supports api for free installation.

rinalmo-mega install url in huggingface.co:

https://huggingface.co/multimolecule/rinalmo-mega

Url of rinalmo-mega

Provider of rinalmo-mega huggingface.co

multimolecule
ORGANIZATIONS

Other API from multimolecule

huggingface.co

Total runs: 12.8K
Run Growth: -20.9K
Growth Rate: -164.14%
Updated:February 02 2026
huggingface.co

Total runs: 1.2K
Run Growth: 107
Growth Rate: 9.01%
Updated:February 02 2026
huggingface.co

Total runs: 310
Run Growth: -7.4K
Growth Rate: -2388.71%
Updated:February 02 2026
huggingface.co

Total runs: 303
Run Growth: 124
Growth Rate: 40.92%
Updated:February 02 2026
huggingface.co

Total runs: 197
Run Growth: 192
Growth Rate: 97.46%
Updated:June 01 2026
huggingface.co

Total runs: 165
Run Growth: -537
Growth Rate: -325.45%
Updated:February 02 2026
huggingface.co

Total runs: 88
Run Growth: 83
Growth Rate: 94.32%
Updated:May 31 2026
huggingface.co

Total runs: 48
Run Growth: 0
Growth Rate: 0.00%
Updated:December 16 2024
huggingface.co

Total runs: 0
Run Growth: 0
Growth Rate: 0.00%
Updated:September 14 2024
huggingface.co

Total runs: 0
Run Growth: 0
Growth Rate: 0.00%
Updated:September 14 2024